complementSeq {Biostrings} | R Documentation |
WARNING: complementSeq
is now defunct and will be removed
soon together with this man page.
See the examples at the bottom of the man page for how to use
complement
instead.
Function to obtain the complementary sequence.
complementSeq(seq, start=1, stop=0)
seq |
Character vector consisting of the letters A, C, G and T. |
start |
Numeric scalar: the sequence position at which to start complementing. If 1, start from the beginning. |
stop |
Numeric scalar: the sequence position at which to stop complementing. If 0, go until the end. |
The complemented sequence for each element of the input is computed and returned. The complement is given by the mapping: A -> T, C -> G, G -> C, T -> A.
An important special case is start=13
, stop=13
:
If seq
is a vector of 25mer sequences on an Affymetrix
GeneChip, complementSeq(seq, start=13, stop=13)
calculates the so-called mismatch sequences.
The function deals only with sequences that represent DNA.
These can consist only of the letters A
, C
, T
or G
. Upper, lower or mixed case is allowed and honored.
A character vector of the same length as seq
is
returned. Each component represents the transformed sequence for the
input value.
R. Gentleman, W. Huber
alphabetFrequency
, reverseComplement
## --------------------------------------------------------------------- ## EXAMPLE 1 ## --------------------------------------------------------------------- seq <- c("AAACT", "GGGTT") ## You can't do this anymore (defunct): if (interactive()) { complementSeq(seq) # was inefficient on large vectors } ## But you can do this instead: complement(DNAStringSet(seq)) ## --------------------------------------------------------------------- ## EXAMPLE 2 ## --------------------------------------------------------------------- seq <- c("CGACTGAGACCAAGACCTACAACAG", "CCCGCATCATCTTTCCTGTGCTCTT") ## You can't do this anymore (defunct): if (interactive()) { complementSeq(seq, start=13, stop=13) } ## But you can do this instead: pm2mm <- function(probes) { probes <- DNAStringSet(probes) subseq(probes, start=13, end=13) <- complement(subseq(probes, start=13, end=13)) probes } pm2mm(seq)