extractTranscriptSeqs {GenomicFeatures} | R Documentation |
extractTranscriptSeqs
extracts transcript (or CDS) sequences from
an object representing a single chromosome or a collection of chromosomes.
extractTranscriptSeqs(x, transcripts, ...) ## S4 method for signature 'DNAString' extractTranscriptSeqs(x, transcripts, strand="+") ## S4 method for signature 'ANY' extractTranscriptSeqs(x, transcripts, ...)
x |
An object representing a single chromosome or a collection of chromosomes.
More precisely, Other objects representing a collection of chromosomes are supported
(e.g. FaFile objects in the Rsamtools package)
as long as |
transcripts |
An object representing the exon ranges of each transcript to extract. More precisely:
Note that, for each transcript, the exons must be ordered by ascending rank, that is, by ascending position in the transcript (when going in the 5' to 3' direction). This generally means (but not always) that they are also ordered from 5' to 3' on the reference genome. More precisely:
If |
... |
Additional arguments, for use in specific methods. For the default method, additional arguments are allowed only when
|
strand |
Only supported when Can be an atomic vector, a factor, or an Rle object,
in which case it indicates the strand of each transcript (i.e. all the
exons in a transcript are considered to be on the same strand).
More precisely: it's turned into a factor (or factor-Rle)
that has the "standard strand levels" (this is done by calling the
|
A DNAStringSet object parallel to
transcripts
, that is, the i-th element in it is the sequence
of the i-th transcript in transcripts
.
Hervé Pagès
coverageByTranscript
for computing coverage by
transcript (or CDS) of a set of ranges.
transcriptLengths
for extracting the transcript
lengths (and other metrics) from a TxDb object.
The transcriptLocs2refLocs
function for converting
transcript-based locations into reference-based locations.
The available.genomes
function in the
BSgenome package for checking avaibility of BSgenome
data packages (and installing the desired one).
The DNAString and DNAStringSet classes defined and documented in the Biostrings package.
The translate
function in the
Biostrings package for translating DNA or RNA sequences
into amino acid sequences.
The GRangesList class defined and documented in the GenomicRanges package.
The IntegerRangesList class defined and documented in the IRanges package.
The exonsBy
function for extracting exon ranges
grouped by transcript.
The TxDb class.
## --------------------------------------------------------------------- ## 1. A TOY EXAMPLE ## --------------------------------------------------------------------- library(Biostrings) ## A chromosome of length 30: x <- DNAString("ATTTAGGACACTCCCTGAGGACAAGACCCC") ## 2 transcripts on 'x': tx1 <- IRanges(1, 8) # 1 exon tx2 <- c(tx1, IRanges(12, 30)) # 2 exons transcripts <- IRangesList(tx1=tx1, tx2=tx2) extractTranscriptSeqs(x, transcripts) ## By default, all the exons are considered to be on the plus strand. ## We can use the 'strand' argument to tell extractTranscriptSeqs() ## to extract them from the minus strand. ## Extract all the exons from the minus strand: extractTranscriptSeqs(x, transcripts, strand="-") ## Note that, for a transcript located on the minus strand, the exons ## should typically be ordered by descending position on the reference ## genome in order to reflect their rank in the transcript: extractTranscriptSeqs(x, IRangesList(tx1=tx1, tx2=rev(tx2)), strand="-") ## Extract the exon of the 1st transcript from the minus strand: extractTranscriptSeqs(x, transcripts, strand=c("-", "+")) ## Extract the 2nd exon of the 2nd transcript from the minus strand: extractTranscriptSeqs(x, transcripts, strand=list("-", c("+", "-"))) ## --------------------------------------------------------------------- ## 2. A REAL EXAMPLE ## --------------------------------------------------------------------- ## Load a genome: library(BSgenome.Hsapiens.UCSC.hg19) genome <- BSgenome.Hsapiens.UCSC.hg19 ## Load a TxDb object: txdb_file <- system.file("extdata", "hg19_knownGene_sample.sqlite", package="GenomicFeatures") txdb <- loadDb(txdb_file) ## Check that 'txdb' is based on the hg19 assembly: txdb ## Extract the exon ranges grouped by transcript from 'txdb': transcripts <- exonsBy(txdb, by="tx", use.names=TRUE) ## Extract the transcript sequences from the genome: tx_seqs <- extractTranscriptSeqs(genome, transcripts) tx_seqs ## A sanity check: stopifnot(identical(width(tx_seqs), unname(sum(width(transcripts))))) ## Note that 'tx_seqs' can also be obtained with: extractTranscriptSeqs(genome, txdb, use.names=TRUE) ## --------------------------------------------------------------------- ## 3. USING extractTranscriptSeqs() TO EXTRACT CDS SEQUENCES ## --------------------------------------------------------------------- cds <- cdsBy(txdb, by="tx", use.names=TRUE) cds_seqs <- extractTranscriptSeqs(genome, cds) cds_seqs ## A sanity check: stopifnot(identical(width(cds_seqs), unname(sum(width(cds))))) ## Note that, alternatively, the CDS sequences can be obtained from the ## transcript sequences by removing the 5' and 3' UTRs: tx_lens <- transcriptLengths(txdb, with.utr5_len=TRUE, with.utr3_len=TRUE) stopifnot(identical(tx_lens$tx_name, names(tx_seqs))) # sanity ## Keep the rows in 'tx_lens' that correspond to a sequence in 'cds_seqs' ## and put them in the same order as in 'cds_seqs': m <- match(names(cds_seqs), names(tx_seqs)) tx_lens <- tx_lens[m, ] utr5_width <- tx_lens$utr5_len utr3_width <- tx_lens$utr3_len cds_seqs2 <- narrow(tx_seqs[m], start=utr5_width+1L, end=-(utr3_width+1L)) stopifnot(identical(as.character(cds_seqs2), as.character(cds_seqs))) ## --------------------------------------------------------------------- ## 4. TRANSLATE THE CDS SEQUENCES ## --------------------------------------------------------------------- prot_seqs <- translate(cds_seqs, if.fuzzy.codon="solve") ## Note that, by default, translate() uses The Standard Genetic Code to ## translate codons into amino acids. However, depending on the organism, ## a different genetic code might be needed to translate CDS sequences ## located on the mitochodrial chromosome. For example, for vertebrates, ## the following code could be used to correct 'prot_seqs': SGC1 <- getGeneticCode("SGC1") chrM_idx <- which(all(seqnames(cds) == "chrM")) prot_seqs[chrM_idx] <- translate(cds_seqs[chrM_idx], genetic.code=SGC1, if.fuzzy.codon="solve")