SHOGUN
3.2.1
|
This page lists ready to run shogun examples for the C# Modular interface.
To run the examples issue
gmcs path/to/shogun/interfaces/csharp_modular/*.cs name_of_example.cs LD_LIBRARY_PATH=path/to/libshogun:path/to/shogun/interfaces/csharp_modular mono name_of_example.exe
// In this example the Averaged Perceptron used to classify toy data. using System; public class classifier_averaged_perceptron_modular{ public static void Main() { modshogun.init_shogun_with_defaults(); double learn_rate = 1.0; int max_iter = 1000; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_twoclass.dat"); RealFeatures feats_train = new RealFeatures(); feats_train.set_feature_matrix(traindata_real); RealFeatures feats_test = new RealFeatures(); feats_test.set_feature_matrix(testdata_real); BinaryLabels labels = new BinaryLabels(trainlab); AveragedPerceptron perceptron = new AveragedPerceptron(feats_train, labels); perceptron.set_learn_rate(learn_rate); perceptron.set_max_iter(max_iter); perceptron.train(); perceptron.set_features(feats_test); double[] out_labels = LabelsFactory.to_binary(perceptron.apply()).get_labels(); foreach(double item in out_labels) { Console.Write(item); } } }
// In this example the Gaussian Naive Bayes algorithm used to classify // toy data using System; public class classifier_gaussiannaivebayes_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_multiclass.dat"); RealFeatures feats_train = new RealFeatures(); feats_train.set_feature_matrix(traindata_real); RealFeatures feats_test = new RealFeatures(); feats_test.set_feature_matrix(testdata_real); MulticlassLabels labels = new MulticlassLabels(trainlab); GaussianNaiveBayes gnb = new GaussianNaiveBayes(feats_train, labels); gnb.train(); double[] out_labels = LabelsFactory.to_multiclass(gnb.apply(feats_test)).get_labels(); foreach(double item in out_labels) { Console.Write(item); } } }
// In this example a multi-class support vector machine is trained on a toy data // set and the trained classifier is then used to predict labels of test // examples. The training algorithm is based on BSVM formulation (L2-soft margin // and the bias added to the objective function) which is solved by the Improved // Mitchell-Demyanov-Malozemov algorithm. The training algorithm uses the Gaussian // kernel of width 2.1 and the regularization constant C=1. The solver stops if the // relative duality gap falls below 1e-5. // // For more details on the used SVM solver see // V.Franc: Optimization Algorithms for Kernel Methods. Research report. // CTU-CMP-2005-22. CTU FEL Prague. 2005. // ftp://cmp.felk.cvut.cz/pub/cmp/articles/franc/Franc-PhD.pdf . // using System; public class classifier_gmnpsvm_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 2.1; double epsilon = 1e-5; double C = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_multiclass.dat"); RealFeatures feats_train = new RealFeatures(); feats_train.set_feature_matrix(traindata_real); RealFeatures feats_test = new RealFeatures(); feats_test.set_feature_matrix(testdata_real); GaussianKernel kernel = new GaussianKernel(feats_train, feats_train, width); MulticlassLabels labels = new MulticlassLabels(trainlab); GMNPSVM svm = new GMNPSVM(C, kernel, labels); svm.set_epsilon(epsilon); svm.train(); kernel.init(feats_train, feats_test); double[] out_labels = LabelsFactory.to_multiclass(svm.apply(feats_test)).get_labels(); foreach(double item in out_labels) { Console.Write(item); } } }
// In this example a two-class support vector machine classifier is trained on a // toy data set and the trained classifier is then used to predict labels of test // examples. As training algorithm Gradient Projection Decomposition Technique // (GPDT) is used with SVM regularization parameter C=1 and a Gaussian // kernel of width 2.1. The solver returns an epsilon-precise (epsilon=1e-5) solution. // // For more details on GPDT solver see http://dm.unife.it/gpdt . // using System; public class classifier_gpbtsvm_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 2.1; double epsilon = 1e-5; double C = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_twoclass.dat"); RealFeatures feats_train = new RealFeatures(); feats_train.set_feature_matrix(traindata_real); RealFeatures feats_test = new RealFeatures(); feats_test.set_feature_matrix(testdata_real); GaussianKernel kernel = new GaussianKernel(feats_train, feats_train, width); BinaryLabels labels = new BinaryLabels(trainlab); GPBTSVM svm = new GPBTSVM(C, kernel, labels); svm.set_epsilon(epsilon); svm.train(); kernel.init(feats_train, feats_test); double[] out_labels = LabelsFactory.to_binary(svm.apply()).get_labels(); foreach(double item in out_labels) { Console.Write(item); } } }
// This example shows usage of a k-nearest neighbor (KNN) classification rule on // a toy data set. The number of the nearest neighbors is set to k=3 and the distances // are measured by the Euclidean metric. Finally, the KNN rule is applied to predict // labels of test examples. using System; public class classifier_knn_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int k = 3; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_multiclass.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); MulticlassLabels labels = new MulticlassLabels(trainlab); KNN knn = new KNN(k, distance, labels); knn.train(); double[] out_labels = LabelsFactory.to_multiclass(knn.apply(feats_test)).get_labels(); foreach(double item in out_labels) { Console.Write(item); } } }
// In this example a multi-class support vector machine classifier is trained on a // toy data set and the trained classifier is then used to predict labels of test // examples. As training algorithm the LaRank algorithm is used with SVM // regularization parameter C=1 and a Gaussian kernel of width 2.1 and a precision // set to epsilon=1e-5. // // For more details on LaRank see // Bordes, A. and Bottou, L. and Gallinari, P. and Weston, J. // Solving MultiClass Support Vector Machines with LaRank. ICML 2007. // using System; public class classifier_larank_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 2.1; double epsilon = 1e-5; double C = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_multiclass.dat"); RealFeatures feats_train = new RealFeatures(); feats_train.set_feature_matrix(traindata_real); RealFeatures feats_test = new RealFeatures(); feats_test.set_feature_matrix(testdata_real); GaussianKernel kernel = new GaussianKernel(feats_train, feats_train, width); MulticlassLabels labels = new MulticlassLabels(trainlab); LaRank svm = new LaRank(C, kernel, labels); svm.set_batch_mode(false); svm.set_epsilon(epsilon); svm.train(); double[] out_labels = LabelsFactory.to_multiclass(svm.apply(feats_train)).get_labels(); foreach(double item in out_labels) { Console.Write(item); } } }
// In this example a two-class linear classifier based on the Linear Discriminant // Analysis (LDA) is trained on a toy data set and then the trained classifier is // used to predict test examples. The regularization parameter, which corresponds // to a weight of a unitary matrix added to the covariance matrix, is set to // gamma=3. // // For more details on the LDA see e.g. // http://en.wikipedia.org/wiki/Linear_discriminant_analysis using System; public class classifier_lda_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int gamma = 3; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_twoclass.dat"); RealFeatures feats_train = new RealFeatures(); feats_train.set_feature_matrix(traindata_real); RealFeatures feats_test = new RealFeatures(); feats_test.set_feature_matrix(testdata_real); BinaryLabels labels = new BinaryLabels(trainlab); LDA lda = new LDA(gamma, feats_train, labels); lda.train(); Console.WriteLine(lda.get_bias()); //Console.WriteLine(lda.get_w().toString()); foreach(double item in lda.get_w()) { Console.Write(item); } lda.set_features(feats_test); double[] out_labels = LabelsFactory.to_binary(lda.apply()).get_labels(); foreach(double item in out_labels) { Console.Write(item); } } }
// In this example a two-class linear support vector machine classifier is trained // on a toy data set and the trained classifier is then used to predict labels of // test examples. As training algorithm the LIBLINEAR solver is used with the SVM // regularization parameter C=0.9 and the bias in the classification rule switched // on and the precision parameters epsilon=1e-5. // // For more details on LIBLINEAR see // http://www.csie.ntu.edu.tw/~cjlin/liblinear/ using System; public class classifier_liblinear_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double C = 0.9; double epsilon = 1e-3; Math.init_random(17); double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_twoclass.dat"); RealFeatures feats_train = new RealFeatures(); feats_train.set_feature_matrix(traindata_real); RealFeatures feats_test = new RealFeatures(); feats_test.set_feature_matrix(testdata_real); BinaryLabels labels = new BinaryLabels(trainlab); LibLinear svm = new LibLinear(C, feats_train, labels); svm.set_liblinear_solver_type(LIBLINEAR_SOLVER_TYPE.L2R_L2LOSS_SVC_DUAL); svm.set_epsilon(epsilon); svm.set_bias_enabled(true); svm.train(); svm.set_features(feats_test); double[] out_labels = LabelsFactory.to_binary(svm.apply()).get_labels(); foreach(double item in out_labels) { Console.Write(item); } } }
// In this example a two-class support vector machine classifier is trained on a // 2-dimensional randomly generated data set and the trained classifier is used to // predict labels of test examples. As training algorithm the LIBSVM solver is used // with SVM regularization parameter C=1 and a Gaussian kernel of width 2.1. // // For more details on LIBSVM solver see http://www.csie.ntu.edu.tw/~cjlin/libsvm/ using System; public class classifier_libsvm_minimal_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int num = 1000; double dist = 1.0; double width = 2.1; double C = 1.0; Random RandomNumber = new Random(); double[,] traindata_real = new double[2, num * 2]; for (int i = 0; i < num; i ++) { traindata_real[0, i] = RandomNumber.NextDouble() - dist; traindata_real[0, i + num] = RandomNumber.NextDouble() + dist; traindata_real[1, i] = RandomNumber.NextDouble() - dist; traindata_real[1, i + num] = RandomNumber.NextDouble() + dist; } double[,] testdata_real = new double[2, num * 2]; for (int i = 0; i < num; i ++) { testdata_real[0, i] = RandomNumber.NextDouble() - dist; testdata_real[0, i + num] = RandomNumber.NextDouble() + dist; testdata_real[1, i] = RandomNumber.NextDouble() - dist; testdata_real[1, i + num] = RandomNumber.NextDouble() + dist; } double[] trainlab = new double[num * 2]; for (int i = 0; i < num; i ++) { trainlab[i] = -1; trainlab[i + num] = 1; } double[] testlab = new double[num * 2]; for (int i = 0; i < num; i ++) { testlab[i] = -1; testlab[i + num] = 1; } RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); GaussianKernel kernel = new GaussianKernel(feats_train, feats_train, width); BinaryLabels labels = new BinaryLabels(trainlab); LibSVM svm = new LibSVM(C, kernel, labels); svm.train(); double[] result = LabelsFactory.to_binary(svm.apply(feats_test)).get_labels(); int err_num = 0; for (int i = 0; i < num; i++) { if (result[i] > 0) { err_num += 1; } if (result[i+num] < 0) { err_num += 1; } } double testerr=err_num/(2*num); Console.WriteLine(testerr); } }
// In this example a two-class support vector machine classifier is trained on a // toy data set and the trained classifier is used to predict labels of test // examples. As training algorithm the LIBSVM solver is used with SVM // regularization parameter C=1 and a Gaussian kernel of width 2.1 and the // precision parameter epsilon=1e-5. The example also shows how to retrieve the // support vectors from the train SVM model. // // For more details on LIBSVM solver see http://www.csie.ntu.edu.tw/~cjlin/libsvm/ using System; public class classifier_libsvm_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 2.1; double epsilon = 1e-5; double C = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_twoclass.dat"); RealFeatures feats_train = new RealFeatures(); feats_train.set_feature_matrix(traindata_real); RealFeatures feats_test = new RealFeatures(); feats_test.set_feature_matrix(testdata_real); GaussianKernel kernel = new GaussianKernel(feats_train, feats_train, width); BinaryLabels labels = new BinaryLabels(trainlab); LibSVM svm = new LibSVM(C, kernel, labels); svm.set_epsilon(epsilon); svm.train(); kernel.init(feats_train, feats_test); double[] out_labels = LabelsFactory.to_binary(svm.apply()).get_labels(); foreach(double item in out_labels) { Console.Write(item); } } }
// In this example a one-class support vector machine classifier is trained on a // toy data set. The training algorithm finds a hyperplane in the RKHS which // separates the training data from the origin. The one-class classifier is // typically used to estimate the support of a high-dimesnional distribution. // For more details see e.g. // B. Schoelkopf et al. Estimating the support of a high-dimensional // distribution. Neural Computation, 13, 2001, 1443-1471. // // In the example, the one-class SVM is trained by the LIBSVM solver with the // regularization parameter C=1 and the Gaussian kernel of width 2.1 and the // precision parameter epsilon=1e-5. // // For more details on LIBSVM solver see http://www.csie.ntu.edu.tw/~cjlin/libsvm/ using System; public class classifier_libsvmoneclass_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 2.1; double epsilon = 1e-5; double C = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(); feats_train.set_feature_matrix(traindata_real); RealFeatures feats_test = new RealFeatures(); feats_test.set_feature_matrix(testdata_real); GaussianKernel kernel = new GaussianKernel(feats_train, feats_train, width); LibSVMOneClass svm = new LibSVMOneClass(C, kernel); svm.set_epsilon(epsilon); svm.train(); kernel.init(feats_train, feats_test); double[] out_labels = LabelsFactory.to_binary(svm.apply()).get_labels(); foreach (double item in out_labels) Console.Write(item); } }
// In this example a two-class support vector machine classifier is trained on a // toy data set and the trained classifier is used to predict labels of test // examples. As training algorithm the Minimal Primal Dual SVM is used with SVM // regularization parameter C=1 and a Gaussian kernel of width 1.2 and the // precision parameter 1e-5. // // For more details on the MPD solver see // Kienzle, W. and B. Schölkopf: Training Support Vector Machines with Multiple // Equality Constraints. Machine Learning: ECML 2005, 182-193. (Eds.) Carbonell, // J. G., J. Siekmann, Springer, Berlin, Germany (11 2005) using System; public class classifier_mpdsvm_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 2.1; double epsilon = 1e-5; double C = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); // already tried double[,] double[] trainlab = Load.load_labels("../data/label_train_twoclass.dat"); RealFeatures feats_train = new RealFeatures(); feats_train.set_feature_matrix(traindata_real); RealFeatures feats_test = new RealFeatures(); feats_test.set_feature_matrix(testdata_real); GaussianKernel kernel = new GaussianKernel(feats_train, feats_train, width); BinaryLabels labels = new BinaryLabels(trainlab); MPDSVM svm = new MPDSVM(C, kernel, labels); svm.set_epsilon(epsilon); svm.train(); kernel.init(feats_train, feats_test); // already tried double[,] double[] out_labels = LabelsFactory.to_binary(svm.apply()).get_labels(); foreach (double item in out_labels) Console.Write(item); } }
using System; public class classifier_multiclasslibsvm_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 2.1; double epsilon = 1e-5; double C = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_multiclass.dat"); RealFeatures feats_train = new RealFeatures(); feats_train.set_feature_matrix(traindata_real); RealFeatures feats_test = new RealFeatures(); feats_test.set_feature_matrix(testdata_real); GaussianKernel kernel = new GaussianKernel(feats_train, feats_train, width); MulticlassLabels labels = new MulticlassLabels(trainlab); MulticlassLibSVM svm = new MulticlassLibSVM(C, kernel, labels); svm.set_epsilon(epsilon); svm.train(); kernel.init(feats_train, feats_test); double[] out_labels = LabelsFactory.to_multiclass(svm.apply()).get_labels(); foreach (double item in out_labels) Console.Write(item); } }
// This example shows usage of the Perceptron algorithm for training a two-class // linear classifier, i.e. y = sign( <x,w>+b). The Perceptron algorithm works by // iteratively passing though the training examples and applying the update rule on // those examples which are misclassified by the current classifier. The Perceptron // update rule reads // // w(t+1) = w(t) + alpha * y_t * x_t // b(t+1) = b(t) + alpha * y_t // // where (x_t,y_t) is feature vector and label (must be +1/-1) of the misclassified example // (w(t),b(t)) are the current parameters of the linear classifier // (w(t+1),b(t+1)) are the new parameters of the linear classifier // alpha is the learning rate; in this examples alpha=1 // // The Perceptron algorithm iterates until all training examples are correctly // classified or the prescribed maximal number of iterations, in this example // max_iter=1000, is reached. using System; public class classifier_perceptron_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double learn_rate = 1.0; int max_iter = 1000; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); // already tried double[][] double[] trainlab = Load.load_labels("../data/label_train_twoclass.dat"); RealFeatures feats_train = new RealFeatures(); feats_train.set_feature_matrix(traindata_real); RealFeatures feats_test = new RealFeatures(); feats_test.set_feature_matrix(testdata_real); BinaryLabels labels = new BinaryLabels(trainlab); Perceptron perceptron = new Perceptron(feats_train, labels); perceptron.set_learn_rate(learn_rate); perceptron.set_max_iter(max_iter); perceptron.train(); perceptron.set_features(feats_test); // already tried double[][] double[] out_labels = LabelsFactory.to_binary(perceptron.apply()).get_labels(); foreach (double item in out_labels) Console.Write(item); } }
// In this example an agglomerative hierarchical single linkage clustering method // is used to cluster a given toy data set. Starting with each object being // assigned to its own cluster clusters are iteratively merged. Here the clusters // are merged that have the closest (minimum distance, here set via the Euclidean // distance object) two elements. using System; public class clustering_hierarchical_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int merges = 3; double[,] fm_train = Load.load_numbers("../data/fm_train_real.dat"); RealFeatures feats_train = new RealFeatures(fm_train); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); Hierarchical hierarchical = new Hierarchical(merges, distance); hierarchical.train(); double[] out_distance = hierarchical.get_merge_distances(); int[,] out_cluster = hierarchical.get_cluster_pairs(); } }
// In this example the k-means clustering method is used to cluster a given toy // data set. In k-means clustering one tries to partition n observations into k // clusters in which each observation belongs to the cluster with the nearest mean. // The algorithm class constructor takes the number of clusters and a distance to // be used as input. The distance used in this example is Euclidean distance. // After training one can fetch the result of clustering by obtaining the cluster // centers and their radiuses. //import org.shogun.*; //import org.jblas.*; //import static org.shogun.Math.init_random; using System; public class clustering_kmeans_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int k = 3; // already tried init_random(17) Math.init_random(17); double[,] fm_train = Load.load_numbers("../data/fm_train_real.dat"); RealFeatures feats_train = new RealFeatures(fm_train); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); KMeans kmeans = new KMeans(k, distance); kmeans.train(); double[,] out_centers = kmeans.get_cluster_centers(); kmeans.get_radiuses(); } }
// In this example toy data is being processed using the Isomap algorithm // as described in // // Silva, V. D., & Tenenbaum, J. B. (2003). // Global versus local methods in nonlinear dimensionality reduction. // Advances in Neural Information Processing Systems 15, 15(Figure 2), 721-728. MIT Press. // Retrieved from http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.9.3407&rep=rep1&type=pdf // // Before applying to the data the landmark approximation is enabled with // specified number of landmarks. The landmark approximation is described in // // Sparse multidimensional scaling using landmark points // V De Silva, J B Tenenbaum (2004) Technology, p. 1-4 // // After enabling the landmark approximation k parameter -- the number // of neighbors in the k nearest neighbor graph -- is initialized. using System; public class converter_classicisomap_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] data = Load.load_numbers("../data/fm_train_real.dat"); RealFeatures features = new RealFeatures(data); Isomap preprocessor = new Isomap(); preprocessor.set_target_dim(1); preprocessor.apply(features); } }
// In this example toy data is being preprocessed using the Locally Linear Embedding (LLE) // algorithm as described in // // Saul, L. K., Ave, P., Park, F., & Roweis, S. T. (2001). // An Introduction to Locally Linear Embedding. Available from, 290(5500), 2323-2326. // Retrieved from: http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.123.7319&rep=rep1&type=pdf // // The number of neighbors used during the linear reconstruction step of the algorithm is set // before processing of the data. using System; public class converter_locallylinearembedding_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] data = Load.load_numbers("../data/fm_train_real.dat"); RealFeatures features = new RealFeatures(data); LocallyLinearEmbedding preprocessor = new LocallyLinearEmbedding(); preprocessor.set_target_dim(1); preprocessor.apply(features); } }
// In this example toy data is being processed using the multidimensional // scaling as described on p.261 (Section 12.1) of // // Borg, I., & Groenen, P. J. F. (2005). // Modern multidimensional scaling: Theory and applications. Springer. // // Before processing the landmark approximation is disabled. using System; public class converter_multidimensionalscaling_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] data = Load.load_numbers("../data/fm_train_real.dat"); RealFeatures features = new RealFeatures(data); MultidimensionalScaling mds = new MultidimensionalScaling(); mds.set_target_dim(1); mds.set_landmark(false); mds.apply(features); } }
// An approach as applied below, which shows the processing of input data // from a file becomes a crucial factor for writing your own sample applications. // This approach is just one example of what can be done using the distance // functions provided by shogun. // // First, you need to determine what type your data will be, because this // will determine the distance function you can use. // // This example loads two stored matrices of real values from different // files and initializes the matrices to 'RealFeatures'. // Each column of the matrices corresponds to one data point. // // The distance initialized by two data sets (the same data set as shown in the // first call) controls the processing of the given data points, where a pairwise // distance matrix is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // The method call 'init'* binds the given data sets, where a pairwise distance // matrix between these two data sets is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // *Note that the previous computed distance matrix can no longer be // reaccessed by 'get_distance_matrix'. // // For more details see doc/classshogun_1_1CBrayCurtisDistance.html. // // Obviously, using the Bray Curtis distance is not limited to this showcase // example. using System; public class distance_braycurtis_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); BrayCurtisDistance distance = new BrayCurtisDistance(feats_train, feats_train); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); foreach (double item in dm_train) Console.Write(item); foreach (double item in dm_test) Console.Write(item); } }
// An approach as applied below, which shows the processing of input data // from a file becomes a crucial factor for writing your own sample applications. // This approach is just one example of what can be done using the distance // functions provided by shogun. // // First, you need to determine what type your data will be, because this // will determine the distance function you can use. // // This example loads two stored matrices of real values from different // files and initializes the matrices to 'RealFeatures'. // Each column of the matrices corresponds to one data point. // // The distance initialized by two data sets (the same data set as shown in the // first call) controls the processing of the given data points, where a pairwise // distance (dissimilarity ratio) matrix is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // The method call 'init'* binds the given data sets, where a pairwise distance // matrix between these two data sets is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // *Note that the previous computed distance matrix can no longer be // reaccessed by 'get_distance_matrix'. // // For more details see doc/classshogun_1_1CCanberraMetric.html. // // Obviously, using the Canberra distance is not limited to this showcase // example. using System; public class distance_canberra_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); CanberraMetric distance = new CanberraMetric(feats_train, feats_train); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); foreach(double item in dm_train) { Console.Write(item); } foreach(double item in dm_test) { Console.Write(item); } } }
// An approach as applied below, which shows the processing of input data // from a file becomes a crucial factor for writing your own sample applications. // This approach is just one example of what can be done using the distance // functions provided by shogun. // // First, you need to determine what type your data will be, because this // will determine the distance function you can use. // // This example loads two stored matrices of real values from different // files and initializes the matrices to 'RealFeatures'. // Each column of the matrices corresponds to one data point. // // The distance initialized by two data sets (the same data set as shown in the // first call) controls the processing of the given data points, where a pairwise // distance (maximum of absolute feature dimension differences) matrix is // computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // The method call 'init'* binds the given data sets, where a pairwise distance // (maximum of absolute feature dimension differences) matrix between these // two data sets is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // *Note that the previous computed distance matrix can no longer be // reaccessed by 'get_distance_matrix'. // // For more details see doc/classshogun_1_1CChebyshewMetric.html. // // Obviously, using the Chebyshew distance is not limited to this showcase // example. using System; public class distance_chebyshew_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); ChebyshewMetric distance = new ChebyshewMetric(feats_train, feats_train); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); foreach(double item in dm_train) { Console.Write(item); } foreach(double item in dm_test) { Console.Write(item); } } }
// An approach as applied below, which shows the processing of input data // from a file becomes a crucial factor for writing your own sample applications. // This approach is just one example of what can be done using the distance // functions provided by shogun. // // First, you need to determine what type your data will be, because this // will determine the distance function you can use. // // This example loads two stored matrices of real values from different // files and initializes the matrices to 'RealFeatures'. // Each column of the matrices corresponds to one data point. // // The distance initialized by two data sets (the same data set as shown in the // first call) controls the processing of the given data points, where a pairwise // distance matrix is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // The method call 'init'* binds the given data sets, where a pairwise distance // matrix between these two data sets is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // *Note that the previous computed distance matrix can no longer be // reaccessed by 'get_distance_matrix'. // // For more details see doc/classshogun_1_1CChiSquareDistance.html. // // Obviously, using the ChiSquare distance is not limited to this showcase // example. using System; public class distance_chisquare_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); ChiSquareDistance distance = new ChiSquareDistance(feats_train, feats_train); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); foreach(double item in dm_train) { Console.Write(item); } foreach(double item in dm_test) { Console.Write(item); } } }
// An approach as applied below, which shows the processing of input data // from a file becomes a crucial factor for writing your own sample applications. // This approach is just one example of what can be done using the distance // functions provided by shogun. // // First, you need to determine what type your data will be, because this // will determine the distance function you can use. // // This example loads two stored matrices of real values from different // files and initializes the matrices to 'RealFeatures'. // Each column of the matrices corresponds to one data point. // // The distance initialized by two data sets (the same data set as shown in the // first call) controls the processing of the given data points, where a pairwise // distance matrix is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // The method call 'init'* binds the given data sets, where a pairwise distance // matrix between these two data sets is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // *Note that the previous computed distance matrix can no longer be // reaccessed by 'get_distance_matrix'. // // For more details see doc/classshogun_1_1CCosineDistance.html. // // Obviously, using the Cosine distance is not limited to this showcase // example. using System; public class distance_cosine_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); CosineDistance distance = new CosineDistance(feats_train, feats_train); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); foreach(double item in dm_train) { Console.Write(item); } foreach(double item in dm_test) { Console.Write(item); } } }
// An approach as applied below, which shows the processing of input data // from a file becomes a crucial factor for writing your own sample applications. // This approach is just one example of what can be done using the distance // functions provided by shogun. // // First, you need to determine what type your data will be, because this // will determine the distance function you can use. // // This example loads two stored matrices of real values from different // files and initializes the matrices to 'RealFeatures'. // Each column of the matrices corresponds to one data point. // // The distance initialized by two data sets (the same data set as shown in the // first call) controls the processing of the given data points, where a pairwise // distance matrix is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // The method call 'init'* binds the given data sets, where a pairwise distance // matrix between these two data sets is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // *Note that the previous computed distance matrix can no longer be // reaccessed by 'get_distance_matrix'. // // For more details see doc/classshogun_1_1CEuclidianDistance.html. // // Obviously, using the Euclidian distance is not limited to this showcase // example. using System; public class distance_euclidean_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); foreach(double item in dm_train) { Console.Write(item); } foreach(double item in dm_test) { Console.Write(item); } } }
// An approach as applied below, which shows the processing of input data // from a file becomes a crucial factor for writing your own sample applications. // This approach is just one example of what can be done using the distance // functions provided by shogun. // // First, you need to determine what type your data will be, because this // will determine the distance function you can use. // // This example loads two stored matrices of real values from different // files and initializes the matrices to 'RealFeatures'. // Each column of the matrices corresponds to one data point. // // The distance initialized by two data sets (the same data set as shown in the // first call) controls the processing of the given data points, where a // pairwise distance (shortest path on a sphere) matrix is computed // by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // The method call 'init'* binds the given data sets, where a pairwise distance // (shortest path on a sphere) matrix between these two data sets is // computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // *Note that the previous computed distance matrix can no longer be // reaccessed by 'get_distance_matrix'. // // For more details see doc/classshogun_1_1CGeodesicMetric.html. // // Obviously, using the Geodesic distance is not limited to this showcase // example. using System; public class distance_geodesic_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); GeodesicMetric distance = new GeodesicMetric(feats_train, feats_train); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); foreach(double item in dm_train) { Console.Write(item); } foreach(double item in dm_test) { Console.Write(item); } } }
// This example shows how to compute the Hamming Word Distance for string features. using System; public class distance_hammingword_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int order = 3; int gap = 0; bool reverse = false; bool use_sign = false; String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); String[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); double[] fm_test_real = Load.load_labels("../data/fm_test_real.dat"); StringCharFeatures charfeat = new StringCharFeatures(EAlphabet.DNA); charfeat.set_features(fm_train_dna); StringWordFeatures feats_train = new StringWordFeatures(charfeat.get_alphabet()); feats_train.obtain_from_char(charfeat, order-1, order, gap, reverse); SortWordString preproc = new SortWordString(); preproc.init(feats_train); feats_train.add_preprocessor(preproc); feats_train.apply_preprocessor(); StringCharFeatures charfeat_test = new StringCharFeatures(EAlphabet.DNA); charfeat_test.set_features(fm_test_dna); StringWordFeatures feats_test = new StringWordFeatures(charfeat.get_alphabet()); feats_test.obtain_from_char(charfeat_test, order-1, order, gap, reverse); feats_test.add_preprocessor(preproc); feats_test.apply_preprocessor(); HammingWordDistance distance = new HammingWordDistance(feats_train, feats_train, use_sign); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); } }
// An approach as applied below, which shows the processing of input data // from a file becomes a crucial factor for writing your own sample applications. // This approach is just one example of what can be done using the distance // functions provided by shogun. // // First, you need to determine what type your data will be, because this // will determine the distance function you can use. // // This example loads two stored matrices of real values from different // files and initializes the matrices to 'RealFeatures'. // Each column of the matrices corresponds to one data point. // // The distance initialized by two data sets (the same data set as shown in the // first call) controls the processing of the given data points, where a pairwise // distance (divergence measure based on the Kullback-Leibler divergence) matrix // is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // The method call 'init'* binds the given data sets, where a pairwise distance // (divergence measure based on the Kullback-Leibler divergence) matrix between // these two data sets is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // *Note that the previous computed distance matrix can no longer be // reaccessed by 'get_distance_matrix'. // // For more details see doc/classshogun_1_1CJensenMetric.html. // // Obviously, using the Jensen-Shannon distance/divergence is not limited to // this showcase example. using System; public class distance_jensen_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); JensenMetric distance = new JensenMetric(feats_train, feats_train); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); foreach(double item in dm_train) { Console.Write(item); } foreach(double item in dm_test) { Console.Write(item); } } }
// This example shows how to compute the Manahattan Distance for string features. using System; public class distance_manhattenword_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int order = 3; int gap = 0; bool reverse = false; String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); String[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); double[,] fm_test_real = Load.load_numbers("../data/fm_test_real.dat"); StringCharFeatures charfeat = new StringCharFeatures(EAlphabet.DNA); charfeat.set_features(fm_train_dna); StringWordFeatures feats_train = new StringWordFeatures(charfeat.get_alphabet()); feats_train.obtain_from_char(charfeat, order-1, order, gap, reverse); SortWordString preproc = new SortWordString(); preproc.init(feats_train); feats_train.add_preprocessor(preproc); feats_train.apply_preprocessor(); StringCharFeatures charfeat_test = new StringCharFeatures(EAlphabet.DNA); charfeat_test.set_features(fm_test_dna); StringWordFeatures feats_test = new StringWordFeatures(charfeat.get_alphabet()); feats_test.obtain_from_char(charfeat_test, order-1, order, gap, reverse); feats_test.add_preprocessor(preproc); feats_test.apply_preprocessor(); ManhattanWordDistance distance = new ManhattanWordDistance(feats_train, feats_train); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); foreach(double item in dm_train) { Console.Write(item); } foreach(double item in dm_test) { Console.Write(item); } } }
// An approach as applied below, which shows the processing of input data // from a file becomes a crucial factor for writing your own sample applications. // This approach is just one example of what can be done using the distance // functions provided by shogun. // // First, you need to determine what type your data will be, because this // will determine the distance function you can use. // // This example loads two stored matrices of real values from different // files and initializes the matrices to 'RealFeatures'. // Each column of the matrices corresponds to one data point. // // The distance initialized by two data sets (the same data set as shown in the // first call) and norm 'k' controls the processing of the given data points, // where a pairwise distance matrix is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // The method call 'init'* binds the given data sets, where a pairwise distance // matrix between these two data sets is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // *Note that the previous computed distance matrix can no longer be // reaccessed by 'get_distance_matrix'. // // For more details see doc/classshogun_1_1CMinkowskiMetric.html. // // Obviously, using the Minkowski metric is not limited to this showcase // example. using System; public class distance_minkowski_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double k = 3; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); MinkowskiMetric distance = new MinkowskiMetric(feats_train, feats_train, k); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); foreach(double item in dm_train) { Console.Write(item); } foreach(double item in dm_test) { Console.Write(item); } } }
// In this example an squared euclidian distance is being computed for toy data. using System; public class distance_normsquared_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); distance.set_disable_sqrt(true); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); foreach(double item in dm_train) { Console.Write(item); } foreach(double item in dm_test) { Console.Write(item); } } }
// An approach as applied below, which shows the processing of input data // from a file becomes a crucial factor for writing your own sample applications. // This approach is just one example of what can be done using the distance // functions provided by shogun. // // First, you need to determine what type your data will be, because this // will determine the distance function you can use. // // This example loads two stored matrices of real values from different // files and initializes the matrices to 'RealFeatures'. // Each column of the matrices corresponds to one data point. // // The distance initialized by two data sets (the same data set as shown in the // first call) controls the processing of the given data points, where a pairwise // distance (extended Jaccard coefficient) matrix is computed by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // The method call 'init'* binds the given data sets, where a pairwise distance // (extended Jaccard coefficient) matrix between these two data sets is computed // by 'get_distance_matrix'. // // The resulting distance matrix can be reaccessed by 'get_distance_matrix'. // // *Note that the previous computed distance matrix can no longer be // reaccessed by 'get_distance_matrix'. // // For more details see doc/classshogun_1_1CTanimotoDistance.html. // // Obviously, using the Tanimoto distance/coefficient is not limited to // this showcase example. using System; public class distance_tanimoto_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); TanimotoDistance distance = new TanimotoDistance(feats_train, feats_train); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); foreach(double item in dm_train) { Console.Write(item); } foreach(double item in dm_test) { Console.Write(item); } } }
// In this example the Histogram algorithm object computes a histogram over all // 16bit unsigned integers in the features. using System; public class distribution_histogram_modular { public static void Main() { bool reverse = false; modshogun.init_shogun_with_defaults(); int order = 3; int gap = 4; String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); StringCharFeatures charfeat = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringWordFeatures feats = new StringWordFeatures(charfeat.get_alphabet()); feats.obtain_from_char(charfeat, order-1, order, gap, reverse); Histogram histo = new Histogram(feats); histo.train(); double[] histogram = histo.get_histogram(); foreach(double item in histogram) { Console.Write(item); } //int num_examples = feats.get_num_vectors(); //int num_param = histo.get_num_model_parameters(); //double[,] out_likelihood = histo.get_log_likelihood(); //double out_sample = histo.get_log_likelihood_sample(); } }
// In this example a hidden markov model with 3 states and 6 transitions is trained // on a string data set. After calling the constructor of the HMM class specifying // the number of states and transitions the model is trained. Via the Baum-Welch // algorithm the optimal transition and emission probabilities are estimated. The // best path, i.e. the path with highest probability given the model can then be // calculated using get_best_path_state. //import org.shogun.*; //import org.jblas.*; //import static org.shogun.EAlphabet.CUBE; //import static org.shogun.BaumWelchViterbiType.BW_NORMAL; public class distribution_hmm_modular { public static void Main() { bool reverse = false; modshogun.init_shogun_with_defaults(); int N = 1; int M = 512; double pseudo = 1e-5; int order = 3; int gap = 0; string[] fm_train_dna = Load.load_cubes("../data/fm_train_cube.dat"); StringCharFeatures charfeat = new StringCharFeatures(fm_train_dna, EAlphabet.CUBE); StringWordFeatures feats = new StringWordFeatures(charfeat.get_alphabet()); feats.obtain_from_char(charfeat, order-1, order, gap, reverse); HMM hmm = new HMM(feats, N, M, pseudo); hmm.train(); hmm.baum_welch_viterbi_train(BaumWelchViterbiType.BW_NORMAL); int num_examples = feats.get_num_vectors(); int num_param = hmm.get_num_model_parameters(); for (int i = 0; i < num_examples; i++) for(int j = 0; j < num_param; j++) { hmm.get_log_derivative(j, i); } int best_path = 0; int best_path_state = 0; for(int i = 0; i < num_examples; i++){ best_path += (int)hmm.best_path(i); for(int j = 0; j < N; j++) best_path_state += hmm.get_best_path_state(i, j); } double[] lik_example = hmm.get_log_likelihood(); double lik_sample = hmm.get_log_likelihood_sample(); } }
// Trains an inhomogeneous Markov chain of order 3 on a DNA string data set. Due to // the structure of the Markov chain it is very similar to a HMM with just one // chain of connected hidden states - that is why we termed this linear HMM. using System; public class distribution_linearhmm_modular { public static void Main() { bool reverse = false; modshogun.init_shogun_with_defaults(); int order = 3; int gap = 4; String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); StringCharFeatures charfeat = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringWordFeatures feats = new StringWordFeatures(charfeat.get_alphabet()); feats.obtain_from_char(charfeat, order-1, order, gap, reverse); LinearHMM hmm = new LinearHMM(feats); hmm.train(); hmm.get_transition_probs(); int num_examples = feats.get_num_vectors(); int num_param = hmm.get_num_model_parameters(); for (int i = 0; i < num_examples; i++) for(int j = 0; j < num_param; j++) { hmm.get_log_derivative(j, i); } double[] out_likelihood = hmm.get_log_likelihood(); double out_sample = hmm.get_log_likelihood_sample(); } }
// In this example various (accuracy, error rate, ..) measures are being computed // for the pair of ground truth toy data and random data. using System; public class evaluation_contingencytableevaluation_modular { public static void Main(string[] argv) { modshogun.init_shogun_with_defaults(); double[] ground_truth = Load.load_labels("../data/label_train_twoclass.dat"); Random RandomNumber = new Random(); double[] predicted = new double[ground_truth.Length]; for (int i = 0; i < ground_truth.Length; i++) { predicted[i] = RandomNumber.NextDouble(); } BinaryLabels ground_truth_labels = new BinaryLabels(ground_truth); BinaryLabels predicted_labels = new BinaryLabels(predicted); ContingencyTableEvaluation base_evaluator = new ContingencyTableEvaluation(); base_evaluator.evaluate(predicted_labels,ground_truth_labels); AccuracyMeasure evaluator1 = new AccuracyMeasure(); double accuracy = evaluator1.evaluate(predicted_labels,ground_truth_labels); ErrorRateMeasure evaluator2 = new ErrorRateMeasure(); double errorrate = evaluator2.evaluate(predicted_labels,ground_truth_labels); BALMeasure evaluator3 = new BALMeasure(); double bal = evaluator3.evaluate(predicted_labels,ground_truth_labels); WRACCMeasure evaluator4 = new WRACCMeasure(); double wracc = evaluator4.evaluate(predicted_labels,ground_truth_labels); F1Measure evaluator5 = new F1Measure(); double f1 = evaluator5.evaluate(predicted_labels,ground_truth_labels); CrossCorrelationMeasure evaluator6 = new CrossCorrelationMeasure(); double crosscorrelation = evaluator6.evaluate(predicted_labels,ground_truth_labels); RecallMeasure evaluator7 = new RecallMeasure(); double recall = evaluator7.evaluate(predicted_labels,ground_truth_labels); PrecisionMeasure evaluator8 = new PrecisionMeasure(); double precision = evaluator8.evaluate(predicted_labels,ground_truth_labels); SpecificityMeasure evaluator9 = new SpecificityMeasure(); double specificity = evaluator9.evaluate(predicted_labels,ground_truth_labels); Console.Write("{0}, {1}, {2}, {3}, {4}, {5}, {6}, {7}, {8}\n", accuracy, errorrate, bal, wracc, f1, crosscorrelation, recall, precision, specificity); } }
using System; public class features_dense_real_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double[,] matrix = new double[6, 3]{{1,2,3},{4,0,0},{0,0,0},{0,5,0},{0,0,6},{9,9,9}}; RealFeatures a = new RealFeatures(matrix); a.set_feature_vector(new double[] {1, 4, 0, 0, 0, 9}, 0); double[,] a_out = a.get_feature_matrix(); foreach(double item in a_out) { Console.Write("{0} ", item); } } }
// Creates features similar to the feature space of the SNP kernel. Useful when // working with linear methods. //import org.shogun.*; //import org.jblas.*; //import static org.shogun.EAlphabet.SNP; //import java.util.ArrayList; //import java.util.Arrays; //import java.util.List; public class features_snp_modular { public static void Main() { modshogun.init_shogun_with_defaults(); string filename = "../data/snps.dat"; StringByteFeatures sf = new StringByteFeatures(EAlphabet.SNP); sf.load_ascii_file(filename, false, EAlphabet.SNP, EAlphabet.SNP); SNPFeatures snps = new SNPFeatures(sf); } }
// This example demonstrates how to encode ASCII-strings (255 symbols) in shogun. using System; public class features_string_char_modular { public static void Main() { modshogun.init_shogun_with_defaults(); string [] strings = new string[6] { "hey","guys","i","am","a","string"}; StringCharFeatures f = new StringCharFeatures(strings, EAlphabet.RAWBYTE); string [] r = f.get_features(); foreach(string item in r) { Console.WriteLine(item); } } }
// This creates a HashedWDFeatures object, i.e. an approximation to the Weighted // Degree kernel feature space via hashes. These features can be particularly fast // in linear SVM solvers. using System; public class features_string_hashed_wd_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int order = 3; int start_order = 1; int hash_bits = 2; int from_order = order; StringByteFeatures f = new StringByteFeatures(EAlphabet.RAWDNA); HashedWDFeatures y = new HashedWDFeatures(f,start_order,order,from_order,hash_bits); } }
// In this example, we demonstrate how to obtain string features // by using a sliding window in a memory-efficient way. Instead of copying // the string for each position of the sliding window, we only store a reference // with respect to the complete string. This is particularly useful, when working // with genomic data, where storing all explicitly copied strings in memory // quickly becomes infeasible. In addition to a sliding window (of a particular // length) over all position, we also support defining a custom position // list. using System; public class features_string_sliding_window_modular { public static void Main() { modshogun.init_shogun_with_defaults(); String[] strings = new String[] {"AAAAAAAAAACCCCCCCCCCGGGGGGGGGGTTTTTTTTTT"}; StringCharFeatures f = new StringCharFeatures(strings, EAlphabet.DNA); f.obtain_by_sliding_window(5,1); DynamicIntArray positions = new DynamicIntArray(); positions.append_element(0); positions.append_element(6); positions.append_element(16); positions.append_element(25); //f.obtain_by_position_list(8,positions); } }
// In this example the ANOVA kernel is being computed for toy data. using System; public class kernel_anova_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int cardinality = 2; int size_cache = 5; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); ANOVAKernel kernel = new ANOVAKernel(feats_train, feats_train, cardinality, size_cache); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); } }
// This example demonstrates the use of the AUC Kernel, which // can be used to maximize AUC instead of margin in SVMs. using System; public class kernel_auc_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 1.6; double[,] train_real = Load.load_numbers("../data/fm_train_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_twoclass.dat"); RealFeatures feats_train = new RealFeatures(train_real); GaussianKernel subkernel = new GaussianKernel(feats_train, feats_train, width); BinaryLabels labels = new BinaryLabels(trainlab); AUCKernel kernel = new AUCKernel(0, subkernel); kernel.setup_auc_maximization(labels); double[,] km_train = kernel.get_kernel_matrix(); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); Console.Write("km_train:\n"); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } } }
// In this example the Cauchy kernel is being computed for toy data. using System; public class kernel_cauchy_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double sigma = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); CauchyKernel kernel = new CauchyKernel(feats_train, feats_train, sigma, distance); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test=kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// This is an example for the initialization of the chi2-kernel on real data, where // each column of the matrices corresponds to one training/test example. using System; public class kernel_chi2_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 1.4; int size_cache = 10; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); Chi2Kernel kernel = new Chi2Kernel(feats_train, feats_train, width, size_cache); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test=kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// In this example the circular kernel is being computed for toy data. using System; public class kernel_circular_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double sigma = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); CircularKernel kernel = new CircularKernel(feats_train, feats_train, sigma, distance); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test=kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// This is an example for the initialization of a combined kernel, which is a weighted sum of // in this case three kernels on real valued data. The sub-kernel weights are all set to 1. // //import org.shogun.*; //import org.jblas.*; //import static org.shogun.EAlphabet.DNA; //import java.util.ArrayList; //import java.util.Arrays; //import java.util.List; using System; public class kernel_combined_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int cardinality = 2; int cache = 10; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); String[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); RealFeatures subfeats_train = new RealFeatures(traindata_real); RealFeatures subfeats_test = new RealFeatures(testdata_real); CombinedKernel kernel= new CombinedKernel(); CombinedFeatures feats_train = new CombinedFeatures(); CombinedFeatures feats_test = new CombinedFeatures(); GaussianKernel subkernel = new GaussianKernel(cache, 1.1); feats_train.append_feature_obj(subfeats_train); feats_test.append_feature_obj(subfeats_test); kernel.append_kernel(subkernel); StringCharFeatures subkfeats_train = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringCharFeatures subkfeats_test = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); int degree = 3; FixedDegreeStringKernel subkernel2= new FixedDegreeStringKernel(10, degree); feats_train.append_feature_obj(subkfeats_train); feats_test.append_feature_obj(subkfeats_test); kernel.append_kernel(subkernel2); subkfeats_train = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); subkfeats_test = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); LocalAlignmentStringKernel subkernel3 = new LocalAlignmentStringKernel(10); feats_train.append_feature_obj(subkfeats_train); feats_test.append_feature_obj(subkfeats_test); kernel.append_kernel(subkernel3); kernel.init(feats_train, feats_train); double[,] km_train=kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test=kernel.get_kernel_matrix(); } }
// This is an example for the initialization of the CommUlongString-kernel. This kernel // sums over k-mere matches (k='order'). For efficient computing a preprocessor is used // that extracts and sorts all k-mers. If 'use_sign' is set to one each k-mere is counted // only once. //import org.shogun.*; //import org.jblas.*; //import static org.shogun.EAlphabet.DNA; using System; public class kernel_comm_ulong_string_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int order = 3; int gap = 0; bool reverse = false; bool use_sign = false; String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); String[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); StringCharFeatures charfeat = new StringCharFeatures(EAlphabet.DNA); charfeat.set_features(fm_train_dna); StringUlongFeatures feats_train = new StringUlongFeatures(charfeat.get_alphabet()); feats_train.obtain_from_char(charfeat, order-1, order, gap, reverse); SortUlongString preproc = new SortUlongString(); preproc.init(feats_train); feats_train.add_preprocessor(preproc); feats_train.apply_preprocessor(); StringCharFeatures charfeat_test = new StringCharFeatures(EAlphabet.DNA); charfeat_test.set_features(fm_test_dna); StringUlongFeatures feats_test = new StringUlongFeatures(charfeat.get_alphabet()); feats_test.obtain_from_char(charfeat_test, order-1, order, gap, reverse); feats_test.add_preprocessor(preproc); feats_test.apply_preprocessor(); CommUlongStringKernel kernel = new CommUlongStringKernel(feats_train, feats_train, use_sign); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); } }
// The constant kernel gives a trivial kernel matrix with all entries set to the same value // defined by the argument 'c'. // using System; public class kernel_const_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double c = 23; DummyFeatures feats_train = new DummyFeatures(10); DummyFeatures feats_test = new DummyFeatures(17); ConstKernel kernel = new ConstKernel(feats_train, feats_train, c); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test=kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// This is an example for the initialization of the diag-kernel. // The diag kernel has all kernel matrix entries but those on // the main diagonal set to zero. using System; public class kernel_diag_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double diag = 23; DummyFeatures feats_train = new DummyFeatures(10); DummyFeatures feats_test = new DummyFeatures(17); ConstKernel kernel = new ConstKernel(feats_train, feats_train, diag); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test=kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// With the distance kernel one can use any of the following distance metrics: // BrayCurtisDistance() // CanberraMetric() // CanberraWordDistance() // ChebyshewMetric() // ChiSquareDistance() // CosineDistance() // Distance() // EuclidianDistance() // GeodesicMetric() // HammingWordDistance() // JensenMetric() // ManhattanMetric() // ManhattanWordDistance() // MinkowskiMetric() // RealDistance() // SimpleDistance() // SparseDistance() // SparseEuclidianDistance() // StringDistance() // TanimotoDistance() // using System; public class kernel_distance_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 1.7; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(); DistanceKernel kernel = new DistanceKernel(feats_train, feats_test, width, distance); double[,] dm_train = distance.get_distance_matrix(); distance.init(feats_train, feats_test); double[,] dm_test = distance.get_distance_matrix(); // Parse and Display km_train Console.Write("dm_train:\n"); int numRows = dm_train.GetLength(0); int numCols = dm_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(dm_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\ndm_test:\n"); numRows = dm_test.GetLength(0); numCols = dm_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(dm_test[i,j] +" "); } Console.Write("\n"); } } }
// The FixedDegree String kernel takes as input two strings of same size and counts the number of matches of length d. using System; public class kernel_fixed_degree_string_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int degree = 4; String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); String[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); StringCharFeatures feats_train = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringCharFeatures feats_test = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); FixedDegreeStringKernel kernel = new FixedDegreeStringKernel(feats_train, feats_train, degree); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); } }
// The well known Gaussian kernel (swiss army knife for SVMs) on dense real valued features. using System; public class kernel_gaussian_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 1.3; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); GaussianKernel kernel = new GaussianKernel(feats_train, feats_train, width); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); foreach(double item in km_train) { Console.Write(item); } foreach(double item in km_test) { Console.Write(item); } } }
// In this example the inverse multiquadic kernel is being computed for toy data. using System; public class kernel_inversemultiquadric_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double shift_coef = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); InverseMultiQuadricKernel kernel = new InverseMultiQuadricKernel(feats_train, feats_test, shift_coef, distance); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// example on saving a kernel to a file using System; public class kernel_io_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 1.2; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); GaussianKernel kernel = new GaussianKernel(feats_train, feats_test, width); double[,] km_train = kernel.get_kernel_matrix(); CSVFile f=new CSVFile("gaussian_train.ascii",'w'); kernel.save(f); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); CSVFile f_test=new CSVFile("gaussian_train.ascii",'w'); kernel.save(f_test); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// This is an example for the initialization of a linear kernel on real valued // data using scaling factor 1.2. using System; public class kernel_linear_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double scale = 1.2; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); LinearKernel kernel = new LinearKernel(feats_train, feats_test); kernel.set_normalizer(new AvgDiagKernelNormalizer(scale)); kernel.init(feats_train, feats_train); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// This is an example for the initialization of a linear kernel on word (2byte) // data. using System; public class kernel_linear_word_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double scale = 1.2; double[,] traindata_real = Load.load_numbers("../data/fm_train_word.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_word.dat"); short[,] traindata_word = new short[traindata_real.GetLength(0), traindata_real.GetLength(1)]; for (int i = 0; i < traindata_real.GetLength(0); i++){ for (int j = 0; j < traindata_real.GetLength(1); j++) traindata_word[i, j] = (short)traindata_real[i, j]; } short[,] testdata_word = new short[testdata_real.GetLength(0), testdata_real.GetLength(1)]; for (int i = 0; i < testdata_real.GetLength(0); i++){ for (int j = 0; j < testdata_real.GetLength(1); j++) testdata_word[i, j] = (short)testdata_real[i, j]; } WordFeatures feats_train = new WordFeatures(traindata_word); WordFeatures feats_test = new WordFeatures(testdata_word); LinearKernel kernel = new LinearKernel(feats_train, feats_test); kernel.set_normalizer(new AvgDiagKernelNormalizer(scale)); kernel.init(feats_train, feats_train); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); foreach(double item in km_train) { Console.Write(item); } foreach(double item in km_test) { Console.Write(item); } } }
// This is an example for the initialization of the local alignment kernel on // DNA sequences, where each column of the matrices of type char corresponds to // one training/test example. using System; public class kernel_local_alignment_string_modular { public static void Main() { modshogun.init_shogun_with_defaults(); String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); String[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); StringCharFeatures feats_train = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringCharFeatures feats_test = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); LocalAlignmentStringKernel kernel = new LocalAlignmentStringKernel(feats_train, feats_train); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); } }
// The LocalityImprovedString kernel is inspired by the polynomial kernel. // Comparing neighboring characters it puts emphasize on local features. // // It can be defined as // K({\bf x},{\bf x'})=\left(\sum_{i=0}^{T-1}\left(\sum_{j=-l}^{+l}w_jI_{i+j}({\bf x},{\bf x'})\right)^{d_1}\right)^{d_2}, // where // I_i({\bf x},{\bf x'})=1 // if $x_i=x'_i and 0 otherwise. // using System; public class kernel_locality_improved_string_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int length = 5; int inner_degree = 5; int outer_degree = 7; String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); String[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); StringCharFeatures feats_train = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringCharFeatures feats_test = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); LocalityImprovedStringKernel kernel = new LocalityImprovedStringKernel(feats_train, feats_train, length, inner_degree, outer_degree); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); } }
// In this example the log kernel (logarithm of the distance powered by degree plus one) is being computed for toy data. using System; public class kernel_log_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double degree = 2.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); WaveKernel kernel = new WaveKernel(feats_train, feats_test, degree, distance); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); foreach (double item in km_train) Console.Write(item); foreach (double item in km_test) Console.Write(item); } }
// In this example the match word string kernel is being computed for toy data using System; public class kernel_match_word_string_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int degree = 20; double scale = 1.4; int size_cache = 10; int order = 3; int gap = 0; bool reverse = false; String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); String[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); StringCharFeatures charfeat = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringWordFeatures feats_train = new StringWordFeatures(EAlphabet.DNA); feats_train.obtain_from_char(charfeat, order-1, order, gap, reverse); StringCharFeatures charfeat_test = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); StringWordFeatures feats_test = new StringWordFeatures(EAlphabet.DNA); feats_test.obtain_from_char(charfeat_test, order-1, order, gap, reverse); MatchWordStringKernel kernel = new MatchWordStringKernel(size_cache, degree); kernel.set_normalizer(new AvgDiagKernelNormalizer(scale)); kernel.init(feats_train, feats_train); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); } }
// In this example the multiquadric kernel is being computed for toy data. using System; public class kernel_multiquadric_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double shift_coef = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); MultiquadricKernel kernel = new MultiquadricKernel(feats_train, feats_test, shift_coef, distance); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); foreach(double item in km_train) { Console.Write(item); } foreach(double item in km_test) { Console.Write(item); } } }
// This is an example initializing the oligo string kernel which takes distances // between matching oligos (k-mers) into account via a gaussian. Variable 'k' defines the length // of the oligo and variable 'w' the width of the gaussian. The oligo string kernel is // implemented for the DNA-alphabet 'ACGT'. // using System; public class kernel_oligo_string_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int size_cache = 3; int k = 1; double width = 10; String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); String[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); StringCharFeatures feats_train = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringCharFeatures feats_test = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); OligoStringKernel kernel = new OligoStringKernel(size_cache, k, width); kernel.init(feats_train, feats_train); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); } }
// In this example the poly match string kernel is being computed for toy data. using System; public class kernel_poly_match_string_modular { public static void Main() { modshogun.init_shogun_with_defaults(); bool reverse = false; int degree = 3; String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); String[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); StringCharFeatures feats_train = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringCharFeatures feats_test = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); PolyMatchStringKernel kernel = new PolyMatchStringKernel(feats_train, feats_train, degree, true); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test=kernel.get_kernel_matrix(); } }
// This is an example for the initialization of the PolyMatchString kernel on string data. // The PolyMatchString kernel sums over the matches of two stings of the same length and // takes the sum to the power of 'degree'. The strings consist of the characters 'ACGT' corresponding // to the DNA-alphabet. Each column of the matrices of type char corresponds to // one training/test example. using System; public class kernel_poly_match_word_string_modular { public static void Main() { modshogun.init_shogun_with_defaults(); bool reverse = false; int order = 3; int gap = 0; int degree = 2; string[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); string[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); StringCharFeatures charfeat = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringWordFeatures feats_train = new StringWordFeatures(charfeat.get_alphabet()); feats_train.obtain_from_char(charfeat, order-1, order, gap, false); charfeat = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); StringWordFeatures feats_test = new StringWordFeatures(charfeat.get_alphabet()); feats_test.obtain_from_char(charfeat, order-1, order, gap, false); PolyMatchWordStringKernel kernel = new PolyMatchWordStringKernel(feats_train, feats_train, degree, true); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test=kernel.get_kernel_matrix(); } }
// This example initializes the polynomial kernel with real data. // If variable 'inhomogene' is 'True' +1 is added to the scalar product // before taking it to the power of 'degree'. If 'use_normalization' is // set to 'true' then kernel matrix will be normalized by the square roots // of the diagonal entries. using System; public class kernel_poly_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int degree = 4; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); PolyKernel kernel = new PolyKernel(feats_train, feats_train, degree, false); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// In this example the power kernel is being computed for toy data. //import org.shogun.*; //import org.jblas.*; using System; public class kernel_power_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double degree = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); PowerKernel kernel = new PowerKernel(feats_train, feats_test, degree, distance); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); foreach (double item in km_train) Console.Write(item); foreach (double item in km_test) Console.Write(item); } }
// In this example the rational quadratic kernel is being computed for toy data. using System; public class kernel_rationalquadratic_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double shift_coef = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); RationalQuadraticKernel kernel = new RationalQuadraticKernel(feats_train, feats_test, shift_coef, distance); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// The SalzbergWordString kernel implements the Salzberg kernel. // // It is described in // // Engineering Support Vector Machine Kernels That Recognize Translation Initiation Sites // A. Zien, G.Raetsch, S. Mika, B. Schoelkopf, T. Lengauer, K.-R. Mueller // using System; public class kernel_salzberg_word_string_modular { public static void Main() { modshogun.init_shogun_with_defaults(); bool reverse = false; int order = 3; int gap = 0; String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); String[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); StringCharFeatures charfeat = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringWordFeatures feats_train = new StringWordFeatures(charfeat.get_alphabet()); feats_train.obtain_from_char(charfeat, order-1, order, gap, false); charfeat = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); StringWordFeatures feats_test = new StringWordFeatures(charfeat.get_alphabet()); feats_test.obtain_from_char(charfeat, order-1, order, gap, false); BinaryLabels labels = new BinaryLabels(Load.load_labels("../data/label_train_dna.dat")); PluginEstimate pie = new PluginEstimate(); pie.set_labels(labels); pie.set_features(feats_train); pie.train(); SalzbergWordStringKernel kernel = new SalzbergWordStringKernel(feats_train, feats_train, pie, labels); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); pie.set_features(feats_test); LabelsFactory.to_binary(pie.apply()).get_labels(); double[,] km_test=kernel.get_kernel_matrix(); } }
// The standard Sigmoid kernel computed on dense real valued features. using System; public class kernel_sigmoid_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int size_cache = 10; double gamma = 1.2; double coef0 = 1.3; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); SigmoidKernel kernel = new SigmoidKernel(feats_train, feats_test, size_cache, gamma, coef0); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// In this example the spherical kernel is being computed for toy data. using System; public class kernel_spherical_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double sigma = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); MultiquadricKernel kernel = new MultiquadricKernel(feats_train, feats_test, sigma, distance); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// In this example the spline kernel is being computed for toy data. using System; public class kernel_spline_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double sigma = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); SplineKernel kernel = new SplineKernel(feats_train, feats_test); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// In this example the t-Student's kernel is being computed for toy data. using System; public class kernel_tstudent_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double degree = 2.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); TStudentKernel kernel = new TStudentKernel(feats_train, feats_test, degree, distance); double[,] km_train = kernel.get_kernel_matrix(); distance.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// In this example the wave kernel is being computed for toy data. using System; public class kernel_wave_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double theta = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); EuclideanDistance distance = new EuclideanDistance(feats_train, feats_train); WaveKernel kernel = new WaveKernel(feats_train, feats_test, theta, distance); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// In this example the wavelet kernel is being computed for toy data. using System; public class kernel_wavelet_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double theta = 1.0; double dilation = 1.5; double translation = 1.0; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); WaveletKernel kernel = new WaveletKernel(feats_train, feats_test, 10, dilation, translation); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// The WeightedCommWordString kernel may be used to compute the weighted // spectrum kernel (i.e. a spectrum kernel for 1 to K-mers, where each k-mer // length is weighted by some coefficient \f$\beta_k\f$) from strings that have // been mapped into unsigned 16bit integers. // // These 16bit integers correspond to k-mers. To applicable in this kernel they // need to be sorted (e.g. via the SortWordString pre-processor). // // It basically uses the algorithm in the unix "comm" command (hence the name) // to compute: // // k({\bf x},({\bf x'})= \sum_{k=1}^K\beta_k\Phi_k({\bf x})\cdot \Phi_k({\bf x'}) // // where \f$\Phi_k\f$ maps a sequence \f${\bf x}\f$ that consists of letters in // \f$\Sigma\f$ to a feature vector of size \f$|\Sigma|^k\f$. In this feature // vector each entry denotes how often the k-mer appears in that \f${\bf x}\f$. // // Note that this representation is especially tuned to small alphabets // (like the 2-bit alphabet DNA), for which it enables spectrum kernels // of order 8. // // For this kernel the linadd speedups are quite efficiently implemented using // direct maps. // using System; public class kernel_weighted_comm_word_string_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int degree = 20; String[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); String[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); StringCharFeatures feats_train = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringCharFeatures feats_test = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); WeightedDegreePositionStringKernel kernel = new WeightedDegreePositionStringKernel(feats_train, feats_train, degree); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); } }
// This examples shows how to create a Weighted Degree String Kernel from data // and how to compute the kernel matrix from the resulting object. using System; public class kernel_weighted_degree_string_modular { public static void Main() { modshogun.init_shogun_with_defaults(); int degree = 3; string[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); string[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); foreach(string item in fm_train_dna) { Console.WriteLine(item); } StringCharFeatures feats_train = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringCharFeatures feats_test = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); WeightedDegreeStringKernel kernel = new WeightedDegreeStringKernel(feats_train, feats_train, degree); double [] w = new double[degree]; double sum = degree * (degree + 1)/2; for (int i = 0; i < degree; i++) { w[i] = (degree - i)/sum; } kernel.set_wd_weights(w); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); foreach(double item in km_train) { Console.Write(item); } foreach(double item in km_test) { Console.Write(item); } } }
using System; public class HelloWorld { public static void Main(string[] args) { modshogun.init_shogun_with_defaults(); GaussianKernel k = new GaussianKernel(); Console.WriteLine(k.get_width()); } }
// In this example we show how to perform Multiple Kernel Learning (MKL) // with the modular interface. First, we create a number of base kernels. // These kernels can capture different views of the same features, or actually // consider entirely different features associated with the same example // (e.g. DNA sequences = strings AND gene expression data = real values of the same tissue sample). // The base kernels are then subsequently added to a CombinedKernel, which // contains a weight for each kernel and encapsulates the base kernels // from the training procedure. When the CombinedKernel between two examples is // evaluated it computes the corresponding linear combination of kernels according to their weights. // We then show how to create an MKLClassifier that trains an SVM and learns the optimal // weighting of kernels (w.r.t. a given norm q) at the same time. // Finally, the example shows how to classify with a trained MKLClassifier. // using System; public class mkl_binclass_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 2.1; double epsilon = 1e-5; double C = 1.0; int mkl_norm = 2; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_twoclass.dat"); RealFeatures tfeats = new RealFeatures(traindata_real); PolyKernel tkernel = new PolyKernel(10,3); tkernel.init(tfeats, tfeats); double[,] K_train = tkernel.get_kernel_matrix(); RealFeatures pfeats = new RealFeatures(testdata_real); tkernel.init(tfeats, pfeats); double[,] K_test = tkernel.get_kernel_matrix(); CombinedFeatures feats_train = new CombinedFeatures(); feats_train.append_feature_obj(new RealFeatures(traindata_real)); CombinedKernel kernel = new CombinedKernel(); kernel.append_kernel(new CustomKernel(K_train)); kernel.append_kernel(new PolyKernel(10,2)); kernel.init(feats_train, feats_train); BinaryLabels labels = new BinaryLabels(trainlab); MKLClassification mkl = new MKLClassification(); mkl.set_mkl_norm(1); mkl.set_kernel(kernel); mkl.set_labels(labels); mkl.train(); CombinedFeatures feats_pred = new CombinedFeatures(); feats_pred.append_feature_obj(new RealFeatures(testdata_real)); CombinedKernel kernel2 = new CombinedKernel(); kernel2.append_kernel(new CustomKernel(K_test)); kernel2.append_kernel(new PolyKernel(10, 2)); kernel2.init(feats_train, feats_pred); mkl.set_kernel(kernel2); mkl.apply(); } }
// In this example we show how to perform Multiple Kernel Learning (MKL) // with the modular interface for multi-class classification. // First, we create a number of base kernels and features. // These kernels can capture different views of the same features, or actually // consider entirely different features associated with the same example // (e.g. DNA sequences = strings AND gene expression data = real values of the same tissue sample). // The base kernels are then subsequently added to a CombinedKernel, which // contains a weight for each kernel and encapsulates the base kernels // from the training procedure. When the CombinedKernel between two examples is // evaluated it computes the corresponding linear combination of kernels according to their weights. // We then show how to create an MKLMultiClass classifier that trains an SVM and learns the optimal // weighting of kernels (w.r.t. a given norm q) at the same time. The main difference to the binary // classification version of MKL is that we can use more than two values as labels, when training // the classifier. // Finally, the example shows how to classify with a trained MKLMultiClass classifier. // using System; public class mkl_multiclass_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 2.1; double epsilon = 1e-5; double C = 1.0; int mkl_norm = 2; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_multiclass.dat"); CombinedKernel kernel = new CombinedKernel(); CombinedFeatures feats_train = new CombinedFeatures(); CombinedFeatures feats_test = new CombinedFeatures(); RealFeatures subkfeats1_train = new RealFeatures(traindata_real); RealFeatures subkfeats1_test = new RealFeatures(testdata_real); GaussianKernel subkernel = new GaussianKernel(10, width); feats_train.append_feature_obj(subkfeats1_train); feats_test.append_feature_obj(subkfeats1_test); kernel.append_kernel(subkernel); RealFeatures subkfeats2_train = new RealFeatures(traindata_real); RealFeatures subkfeats2_test = new RealFeatures(testdata_real); LinearKernel subkernel2 = new LinearKernel(); feats_train.append_feature_obj(subkfeats2_train); feats_test.append_feature_obj(subkfeats2_test); kernel.append_kernel(subkernel2); RealFeatures subkfeats3_train = new RealFeatures(traindata_real); RealFeatures subkfeats3_test = new RealFeatures(testdata_real); PolyKernel subkernel3 = new PolyKernel(10, 2); feats_train.append_feature_obj(subkfeats3_train); feats_test.append_feature_obj(subkfeats3_test); kernel.append_kernel(subkernel3); kernel.init(feats_train, feats_train); MulticlassLabels labels = new MulticlassLabels(trainlab); MKLMulticlass mkl = new MKLMulticlass(C, kernel, labels); mkl.set_epsilon(epsilon); mkl.set_mkl_epsilon(epsilon); mkl.set_mkl_norm(mkl_norm); mkl.train(); kernel.init(feats_train, feats_test); double[] outMatrix = LabelsFactory.to_multiclass(mkl.apply()).get_labels(); } }
// In this example toy data is being processed using the kernel PCA algorithm // as described in // // Schölkopf, B., Smola, A. J., & Muller, K. R. (1999). // Kernel Principal Component Analysis. // Advances in kernel methods support vector learning, 1327(3), 327-352. MIT Press. // Retrieved from http://citeseerx.ist.psu.edu/viewdoc/summary?doi=10.1.1.32.8744i // // A gaussian kernel is used for the processing. using System; public class preprocessor_kernelpca_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 2.0; double threshold = 0.05; double[,] data = Load.load_numbers("../data/fm_train_real.dat"); RealFeatures features = new RealFeatures(data); GaussianKernel kernel = new GaussianKernel(features, features, width); KernelPCA preprocessor = new KernelPCA(kernel); preprocessor.init(features); preprocessor.apply_to_feature_matrix(features); } }
// In this example a kernel matrix is computed for a given real-valued data set. // The kernel used is the Chi2 kernel which operates on real-valued vectors. It // computes the chi-squared distance between sets of histograms. It is a very // useful distance in image recognition (used to detect objects). The preprocessor // LogPlusOne adds one to a dense real-valued vector and takes the logarithm of // each component of it. It is most useful in situations where the inputs are // counts: When one compares differences of small counts any difference may matter // a lot, while small differences in large counts don't. This is what this log // transformation controls for. using System; public class preprocessor_logplusone_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 1.4; int size_cache = 10; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); LogPlusOne preproc = new LogPlusOne(); preproc.init(feats_train); feats_train.add_preprocessor(preproc); feats_train.apply_preprocessor(); feats_test.add_preprocessor(preproc); feats_test.apply_preprocessor(); Chi2Kernel kernel = new Chi2Kernel(feats_train, feats_train, width, size_cache); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); foreach (double item in km_train) Console.Write(item); foreach (double item in km_test) Console.Write(item); } }
// In this example a kernel matrix is computed for a given real-valued data set. // The kernel used is the Chi2 kernel which operates on real-valued vectors. It // computes the chi-squared distance between sets of histograms. It is a very // useful distance in image recognition (used to detect objects). The preprocessor // NormOne, normalizes vectors to have norm 1. using System; public class preprocessor_normone_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 1.4; int size_cache = 10; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); NormOne preproc = new NormOne(); preproc.init(feats_train); feats_train.add_preprocessor(preproc); feats_train.apply_preprocessor(); feats_test.add_preprocessor(preproc); feats_test.apply_preprocessor(); Chi2Kernel kernel = new Chi2Kernel(feats_train, feats_train, width, size_cache); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// In this example toy data is being processed using the // Principal Component Analysis. using System; public class preprocessor_pca_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 1.4; int size_cache = 10; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); RealFeatures features = new RealFeatures(traindata_real); PCA preproc = new PCA(); preproc.init(features); preproc.apply_to_feature_matrix(features); } }
using System; public class preprocessor_prunevarsubmean_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 1.4; int size_cache = 10; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); PruneVarSubMean preproc = new PruneVarSubMean(); preproc.init(feats_train); feats_train.add_preprocessor(preproc); feats_train.apply_preprocessor(); feats_test.add_preprocessor(preproc); feats_test.apply_preprocessor(); Chi2Kernel kernel = new Chi2Kernel(feats_train, feats_train, width, size_cache); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
using System; public class preprocessor_randomfouriergausspreproc_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 1.4; int size_cache = 10; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); RandomFourierGaussPreproc preproc = new RandomFourierGaussPreproc(); preproc.init(feats_train); feats_train.add_preprocessor(preproc); feats_train.apply_preprocessor(); feats_test.add_preprocessor(preproc); feats_test.apply_preprocessor(); Chi2Kernel kernel = new Chi2Kernel(feats_train, feats_train, width, size_cache); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); // Parse and Display km_train Console.Write("km_train:\n"); int numRows = km_train.GetLength(0); int numCols = km_train.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_train[i,j] +" "); } Console.Write("\n"); } // Parse and Display km_test Console.Write("\nkm_test:\n"); numRows = km_test.GetLength(0); numCols = km_test.GetLength(1); for(int i = 0; i < numRows; i++){ for(int j = 0; j < numCols; j++){ Console.Write(km_test[i,j] +" "); } Console.Write("\n"); } } }
// In this example a kernel matrix is computed for a given string data set. The // CommUlongString kernel is used to compute the spectrum kernel from strings that // have been mapped into unsigned 64bit integers. These 64bit integers correspond // to k-mers. To be applicable in this kernel the mapped k-mers have to be sorted. // This is done using the SortUlongString preprocessor, which sorts the indivual // strings in ascending order. The kernel function basically uses the algorithm in // the unix "comm" command (hence the name). Note that this representation enables // spectrum kernels of order 8 for 8bit alphabets (like binaries) and order 32 for // 2-bit alphabets like DNA. For this kernel the linadd speedups are implemented // (though there is room for improvement here when a whole set of sequences is // ADDed) using sorted lists. using System; public class preprocessor_sortulongstring_modular { public static void Main() { modshogun.init_shogun_with_defaults(); bool reverse = false; int order = 3; int gap = 0; string[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); string[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); StringCharFeatures charfeat = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringUlongFeatures feats_train = new StringUlongFeatures(charfeat.get_alphabet()); feats_train.obtain_from_char(charfeat, order-1, order, gap, reverse); charfeat = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); StringUlongFeatures feats_test = new StringUlongFeatures(charfeat.get_alphabet()); feats_test.obtain_from_char(charfeat, order-1, order, gap, reverse); SortUlongString preproc = new SortUlongString(); preproc.init(feats_train); feats_train.add_preprocessor(preproc); feats_train.apply_preprocessor(); feats_test.add_preprocessor(preproc); feats_test.apply_preprocessor(); CommUlongStringKernel kernel = new CommUlongStringKernel(feats_train, feats_train, false); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); } }
// In this example a kernel matrix is computed for a given string data set. The // CommWordString kernel is used to compute the spectrum kernel from strings that // have been mapped into unsigned 16bit integers. These 16bit integers correspond // to k-mers. To be applicable in this kernel the mapped k-mers have to be sorted. // This is done using the SortWordString preprocessor, which sorts the indivual // strings in ascending order. The kernel function basically uses the algorithm in // the unix "comm" command (hence the name). Note that this representation is // especially tuned to small alphabets (like the 2-bit alphabet DNA), for which it // enables spectrum kernels of order up to 8. For this kernel the linadd speedups // are quite efficiently implemented using direct maps. using System; public class preprocessor_sortwordstring_modular { public static void Main() { modshogun.init_shogun_with_defaults(); bool reverse = false; int order = 3; int gap = 0; string[] fm_train_dna = Load.load_dna("../data/fm_train_dna.dat"); string[] fm_test_dna = Load.load_dna("../data/fm_test_dna.dat"); StringCharFeatures charfeat = new StringCharFeatures(fm_train_dna, EAlphabet.DNA); StringWordFeatures feats_train = new StringWordFeatures(charfeat.get_alphabet()); feats_train.obtain_from_char(charfeat, order-1, order, gap, reverse); charfeat = new StringCharFeatures(fm_test_dna, EAlphabet.DNA); StringWordFeatures feats_test = new StringWordFeatures(charfeat.get_alphabet()); feats_test.obtain_from_char(charfeat, order-1, order, gap, reverse); SortWordString preproc = new SortWordString(); preproc.init(feats_train); feats_train.add_preprocessor(preproc); feats_train.apply_preprocessor(); feats_test.add_preprocessor(preproc); feats_test.apply_preprocessor(); CommWordStringKernel kernel = new CommWordStringKernel(feats_train, feats_train, false); double[,] km_train = kernel.get_kernel_matrix(); kernel.init(feats_train, feats_test); double[,] km_test = kernel.get_kernel_matrix(); } }
// In this example a kernelized version of ridge regression (KRR) is trained on a // real-valued data set. The KRR is trained with regularization parameter tau=1e-6 // and a gaussian kernel with width=0.8. The labels of both the train and the test // data can be fetched via krr.classify().get_labels(). using System; public class regression_krr_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 0.8; double tau = 1e-6; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_twoclass.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); GaussianKernel kernel= new GaussianKernel(feats_train, feats_train, width); RegressionLabels labels = new RegressionLabels(trainlab); KernelRidgeRegression krr = new KernelRidgeRegression(tau, kernel, labels); krr.train(feats_train); kernel.init(feats_train, feats_test); double[] out_labels = LabelsFactory.to_regression(krr.apply()).get_labels(); foreach(double item in out_labels) { Console.Write(item); } } }
// In this example a support vector regression algorithm is trained on a // real-valued toy data set. The underlying library used for the SVR training is // LIBSVM. Both the epsilon-SVR and the nu-SVR formulation are used. // Data is a noisy sine wave on which a Gaussian kernel is used. // // For more details on LIBSVM solver see http://www.csie.ntu.edu.tw/~cjlin/libsvm/ . using System; public class regression_libsvr_modular { public static void Main() { modshogun.init_shogun_with_defaults(); double width = 0.8; int C = 1; double epsilon = 1e-5; double tube_epsilon = 1e-2; double[,] traindata_real = Load.load_numbers("../data/fm_train_real.dat"); double[,] testdata_real = Load.load_numbers("../data/fm_test_real.dat"); double[] trainlab = Load.load_labels("../data/label_train_twoclass.dat"); RealFeatures feats_train = new RealFeatures(traindata_real); RealFeatures feats_test = new RealFeatures(testdata_real); GaussianKernel kernel= new GaussianKernel(feats_train, feats_train, width); RegressionLabels labels = new RegressionLabels(trainlab); LibSVR svr = new LibSVR(C, epsilon, kernel, labels); svr.set_tube_epsilon(tube_epsilon); svr.train(); kernel.init(feats_train, feats_test); double[] out_labels = LabelsFactory.to_regression(svr.apply()).get_labels(); foreach (double item in out_labels) Console.Write(out_labels); } }